MetaDome score, the closer to 0, the more intolerant to variation
Wild type sequence
AATGATGGGTTTTATTTCCAGACTT C ACTTCTAATGGTGATTATGGGAGAA
Wild type DNA sequence +/- 25 bp
Mutant sequence
AATGATGGGTTTTATTTCCAGACTT A ACTTCTAATGGTGATTATGGGAGAA
Mutant DNA sequence +/- 25 bp
Export to DEFGEN (hg19)
Export to DEFGEN (hg38)
Literature
LitVar2 : PubMed links of articles citing this variant
LitVar is a web service that allows the search and retrieval of variant
relevant information from the biomedical literature. LitVar uses advanced
text mining and machine learning techniques to normalize different forms
of the same variant into a unique and standardized name so that all
matching articles can be returned regardless of the use of a specific name
in the query. LitVar is freely available to the research community.
Collecting LitVar data...
VarChat : use AI to summarize scientific literature for genomic variant interpretation
VarChat is an open platform that leverages the power of generative artificial
intelligence to support the genomic variant interpretation process by searching
and condensing the scientific literature available for each variant into a brief
yet very infomative text.
Get insights from pertinent scientific literature in seconds
Stay up-to-date with the latest research on genomic variants
Save a lot of time while receiving accurate and detailed genomic information
Query your variant on VarChat
Alternative automated literature tools
Mastermind : Search engine to identify gene, variant, disease, phenotype, and therapy evidence from scientific articles.
The exonic splicing context of the variant including natural splice sites scores is summarized in the graph below:
MaxEntScan results
MaxEntScan scores are presented in the two following tables. Selected scores have:
a |variation| > 15% and
a raw score for mutant or wild-type of at least 3
The upper sequence shows the variation site in red, and the lower sequence the putative splice site considered by MaxEntScan (putative introns are shown as lower case and exons as upper case).
MobiDetails is running SPiPv2 (may last up to 20s)...
dbscSNV / SpliceAI / AbSplice Max results
This table presents dbscSNV and SpliceAI raw delta scores (max distance: 50 bp, for academic users), when available. You can also run spliceAI via the spliceAIlookup API using a distance of 500 bp, and get also raw delta scores. This may take a while especially for genes with multiple transcripts but may help you identify new deep intronic variants. This also gives the opportunity to get spliceAi scores for large insertions or deletions. Details on raw or masked delta scores are available here. While the authors state that masked scores are preferentially used for variant interprétation, raw scores (unmasked) seem to be more informative. You can get masked delta scores with a +/- 500 bp window with this link. For substitutions, a pre-computed score for AbSplice is diplayed when relevant. AbSplice associates SpliceAI, MMSplice and tissue-specific splice site annotations (SpliceMaps). The scores represent the probability that a given variant causes aberrant splicing in a given tissue.
AbSplice Max Tissue score, thresholds ≥ 0.01|0.05|0.2 for impact
Show radar chart
X Radar view of splicing predictors
Values are normalised (0-1), 0 being the less damaging and 1 the most for each predictor.
SpliceAI-visual results
SpliceAI-visual displays SpliceAI raw (absolute) predictions:
Green and red highlights show the variation site on the wild-type and mutant track, respectively
Positive orange bars represent predicted acceptor sites ([0;1]), and negative blue bars donor sites ([-1;0]), the spliceai raw score being the absolute value.
The first track is the spliceai prediction for the entire MANE transcript.
The second track is the prediction for the variant, +/- 10kb inside the transcript (i.e. not considering intergenic nucleotides).
The "inserted nucleotides" track is used to display the scores of the nucleotides being part of the insertion (empty if no insertion)
You can download the Wild-type and mutant bedgraphs in order to load them in your own Desktop IGV or the UCSC genome browser.
Important notice: if your intronic variant is located more than 10kb from one of the two flanking exons, you are advised to click on the "SpliceAI-visual full transcript" button at the top of this text. Depending on the size of your transcript, within 30s-10 minutes (for the DMD gene, the bad news), the whole transcript prediction including the variant will appear as a new track in the igv.js browser, allowing a more accurate prediction for your variant. The good news being that if it has already been computed, it will load automatically.
MobiDetails is running spliceai to bring you SpliceAI-visual...
Classification History
Variant
User
Date
ACMG Classification*
Comments
NM_000492.3(CFTR):c.1397C>A
Current
CFTR-France
2020-06-18
Class 5 (pathogenic)
To modify the classification history, you must be logged in (you might want to create an account before).
* We added an additional 'risk factor' class to the 5 ACMG classes in order to describe low penetrance risk factor variants. Currently, these variants are not sent to the LOVD Global Variome instance.